Welcome to Vector Database!. Reverse transcription (RT) and PCR were … The primer that anneals with the antisense strand or the noncoding strand or the template strand is known as forward primer since forward primer acts as a starting point to the synthesis of coding or the positive strand of the gene. 7(6):561-73. Universal Primers : Sequence (5' - 3') 1492R 5' TACGGYTACCTTGTTACGACTT 3' 27F 5' AGAGTTTGATCMTGGCTCAG 3' 35S-A 5' AAGGGTCTTGCGAAGGATAG 3' 35S-B 5' AGTGGAAAAGGAAGGTGGCT 3' 518F 5' … The results from colony PCR using forward primer of either Ie1 or P2 and the reverse primer of GFP confirmed the alignment of insert in the transfer vector (Fig. 2 f–h). Map and Sequence File: Download Open . If you forget to include a stop, two more codons from the vector LP2 primer will … pfastbac forward ggattattcataccgtccca pfastbac reverse caaatgtggtatggctgatt pgex3 ggagctgcatgtgtcagagg pgex5 ggcaagccacgtttggtg pjet1_2f cgactcactatagggagagcgg c custom primers: pjet1_2r aagaacatcgattttccatggca g pmale tcagactgtcgatgaagc pqe-f cccgaaaagtgccacctg pqe-r gttctgaggtcattactgg -fwd gctcgatacaataaacgcc prh forward ctgtctctatactcccctatag prh reverse … Comments for pFastBacTM Dual 5238 nucleotides f1 origin: bases 102-557 Ampicillin resistance gene: bases 689-1549 pUC origin: bases 1694-2367 Tn7R: bases 2611-2835 Gentamicin resistance gene: bases 2902-3435 (complementary strand) HSV tk polyadenylation signal: bases 3992-4274 (complementary strand) Multiple cloning site: bases 4274-4337 (complementary strand) p10 promoter … M13 Forward (-20) 5'd[GTAAAACGACGGCCAG]3' (16-mer) M13 Forward (-40) 5'd[GTTTTCCCAGTCACGAC]3' (17-mer) M13 Reverse . pFastBac Dual.dna. pFastBac-VP1 was prepared by amplifying VP1 from the original vector (forward We have found this … A pair of primers (Polh-F1-HindIII and Polh-R-BamH1) using pAcBac-PolhED-XXH DNA as a template and the high fidelity pfu enzyme (Agilent Technologies) produced a linear DNA fragment that was digested with HindIII and BamHI . b The accuracy of recombination ECL kit (Amersham, USA). 5’ AA GTT CTG TTC CAG GGG CCC ATG GTG AGC AAG GGC GAG GAG CTG 3‘ Gene LP2 reverse primer . Basic Cloning Vectors; CRISPR Plasmids; Fluorescent Protein Genes & Plasmids; Gateway ® Cloning Vectors; I.M.A.G.E. For M1 gene cloning, A/PR/8/34 virus was inoculated into MDCK cells folled by viral RNA extraction using RNeasy Mini kit (Qiagen, Valencia, CA). Inverse PCR was used to produce pFastBac-M1. The main difference between forward and reverse primers is that forward primers anneal to the antisense strand of the double-stranded DNA, which runs from 3′ to 5′ direction, whereas reverse primers anneal to the sense strand of the double-stranded DNA, which runs from 5′ to 3′ direction.Furthermore, 5′ primers refer to forward primers, while 3′ primers refer to reverse primers. Pharmaceutics 2015, 12, 839−845 840. incubation, the spheroids were washed thrice with fresh growth medium, treated with 250-fold diluted mouse monoclonal anti- … Then, the transformation efficiency was verified by PCR while using both specific pFastBac-HTA primers (M13/ pUC) and restriction enzyme digestion analysis. Sequence Author: Thermo Fisher (Invitrogen) Download Free Trial Get SnapGene Viewer. Insect Cell Vectors pFastBac Dual. Plasmid Sets. Bac-to-Bac ® TOPO ® Cloning and Bac-to-Bac ® TOPO ® Expression System Kits include the control expression plasmid pFastBac ™ Gus, which contains the Gus gene. Standard Vector Primer Name Sequence Length Tm [°C] GC [%] ... pCEP-Forward AGA GCT CGT TTA GTG AAC CG 20 57.3 50 pCEP-Reverse GTG GTT TGT CCA AAC TCA TC 20 55.2 45 pCR3.1-BGHrev TAG AAG GCA CAG TCG AGG 18 56.0 56 pEGFPC1for GAT CAC TCT CGG CAT GGA C 19 58.8 58 pEGFPC1rev CAT TTT ATG TTT CAG GTT CAG GG 23 57.1 39 pEGFPN1for GTC GTA … 1001 S. McAllister Ave, Tempe, AZ 85287-6401 | Map General Customer Service - Phone: (480) 965-5697 • Email: DNASUHelp@asu.edu Payment Questions - Phone: (480) 965-4544 • Email: DNASUPay@asu.edu Page Contact: DNASU help | Biodesign Institute The 438 vectors use the LICvBac Forward primer and the LICv1 Reverse primer. Forward primer has a short nucleotide sequence that is complementary to the 3’ flanking end of the antisense strand. The digested linear DNA fragment was then ligated with T4 DNA ligase into the multiple cloning site (MCS) … 5’-GGTATGGCTGATTATGATC-3’ Gus control plasmid . Sequiserve can provide more than 1000 primers suitable for most known vectors, which enables us to sequence your insert immediately and without further costs.. Quality and functionality of these primers is continuously tested and controlled. TECHNICAL REFERENCE PROMEGA CORPORATION 2800 WOODS HOLLOW ROAD 5MADISON, WI 53711-5399 USA TELEPHONE 608-274-4330 www.promega.com ©2010 ALL RIGHTS RESERVED PART #GE645 Sequencing Primers 5'CCC CAG AAC ATC AGG TTA ATG GCG TCA CTT GTA GAG CTC GTC CAT GCC GAG 3’ Note 3: If no C-terminal tag is included, you need to introduce a stop codon in your LP2 primer. Simply the reverse complement of forward primer for the insert, except the same overhang is on the 5' end of this primer. Reverse primer: 5´-CAACAACGCACAGAATCTAGC-3´ Tm = 58°C. Vector database is a digital collection of vector backbones assembled from publications and commercially available sources. 438-A is an untagged pFastBac LIC Subcloning vector. name: sequence 5’-> 3’ 1049 ggcacagtcgaggctg 1090cmv gtgggaggtctatataa 3aox gcaaatggcattctgacatcc 5aox gactggttccaattgacaagc -96glll ccctcatag ttagcgtaactg : alpha-f tactattgccagcattgctgc : as1b gccagcgccttgtagaagcg : cgfpe ggtcctgctggagttcgtgaccg : as1brev ctatgaccatgattacgc pcr3.1-bghrev tagaaggcacagtcgagg : bgh tagaaggcacagtcgagg : cfr84 … Plasmid pFastBac1 PIK3R1 from Dr. Bert Vogelstein's lab contains the insert PIK3R1 and is published in Cancer Cell. Plasmid pFastBac flag Mel18 from Dr. Robert Kingston's lab contains the insert Mel18 and is published in Mol Cell 2004 Feb 13;13(3):415-25. Lane 1, pFastBac Dual-CMV-EGFP-CMV-GDNF plasmid; lane 2, PCR product of recombinant bacmid DNA amplified with pUC/M13 forward and reverse primers; lane 3, PCR product of recombinant bacmid DNA amplified with the specific and pUC/M13 reverse primers; lane 4, PCR product of non-recombinant bacmid DNA amplified with pUC/M13 forward and reverse primers; lane M1, DL 15,000 DNA … Your time is valuable! Map of pFastBac ™/NT-TOPO® ... Primer Sequence Polyhedrin forward primer . This simplifies primer design. Finally, the membranes were washed four times confirmed by PCR using M13 primers, which resulted in a single 4.7-kb band (about 2.4 kb of the pFastBac HT vector with PBS containing 0.1% Tween 20 and developed by plus 2.3 kb of the hGC). Universal Primers Offered. pfastbac vector forward primer TCGAGGCATGCGGTACCAAGCTTGTCGAG pfastbac vector reverse primer AATTCCGCGCGCTTCGGACCGGGATC Molecular Pharmaceutics Article DOI:10.1021/mp500860x Mol. 5'd[CAGGAAACAGCTATGAC]3' (17-mer) Gene LP1 forward primer . This plasmid is available through Addgene. GAL1 Forward AATATACCTCTATACTTTAACGTC 24 U-19mer Primer GTTTTCCCAGTCACGACGT 19 T7 EEV ATGTCGTAATAACCCCGCCCCG 22 Bluescript KS TCGAGGTCGACGGTATC 17 pFastBac Forward GGATTATTCATACCGTCCCA 20 pFastBac Reverse CAAATGTGGTATGGCTGATT 20 AOX1 Forward GACTGGTTCCAATTGACAAGC 21 AOX1 Reverse GCAAATGGCATTCTGACATCC 21 The following is the list of complimentary Universal Primers offered by our DNA Sequencing facility. As previously stated, pFastBac-HTA was amplified by using two specific primers (forward 5’-TATTCCGGATTATTCATACCGTC, and reverse 5’- GTATGGCTGATTATGATCCTC). DNASU Plasmid Repository • PSI:Biology-Materials Repository. Forward primer: 5´-TTTACTGTTTTCGTAACAGTTTTG-3´ Tm = 62°C. pET Upstream Primer: 5′ (ATG CGT CCG GCG TAG A) 3’ pFastBacForward: 5′ (GGA TTA TTC ATA CCG TCC CA) 3’ pFastBac Reverse: 5′ (CAA ATG TGG TAT GGC TGA TT) 3’ pREP Forward: 5′ (GCT CGA TAC AAT AAA CGC C) 3’ pRSET Reverse: 5’ (TAG TTA TTG CTC AGC GGT GG) 3’ pTrcHis Forward: 5′ (GAG GTA TAT ATT AAT GTA TCG) 3’ pTrcHis Reverse • pFastBac⁄HBM TOPO® Vector containing the C-terminal TEV cleavage sit and His-Tag. 2005 Jun . The findings were then investigated through a 1% agarose gel … 5’-AAATGATAACCATCTCGC-3’ SV40 polyA reverse primer . The expression cassettes containing hybrid promoter, multiple cloning sites, GFP were at the position between transposon elements Tn7R and Tn7L which allowed the site specific transposition of the expression … This is a free resource for the scientific community that is compiled by Addgene.. Macrogen Korea 10F, 254 Beotkkot-ro Geumcheon-gu, Seoul 08511, Rep. of Korea Tel : +82-2-2180-7000 webmaster@macrogen.com Macrogen Singapore Synapse #05-18, pFastBac-Dual (Invitrogen) was used as the transfer vector for co-expression of VP1 with either wild-type or recombinantly modified VP2. Sequences. list of standard primers. This page is informational only - this vector is NOT available from Addgene - please contact the manufacturer for further details. Maryland 1330 Piccard Drive Suite 205 Rockville, MD 20850 Tel. LICvBacF - 5'-TACTTCCAATCCAATCG-3' (Note: ATG must be added to ORF) LICv1 Reverse - 5'-TTATCCACTTCCAATGTTATTA-3' As the target plasmid size gets >20kb you may have to increase the amount of DNA you anneal and/or transform. pFastBac Forward(20-mer): 5'-GGATTATTCATACCGTCCCA-3' pFastBac Reverse(20-mer): 5'-CAAATGTGGTATGGCTGATT-3' U6 primer(19-mer): 5'-GGGCAGGAAGAGGGCCTAT-3' hU6-F primer(21-mer): 5'-GAGGGCCTATTTCCCATGATT-3' LNCX primer (25-mer): 5'-AGCTCGTTTAGTGAACCGTCAGATC-3' WPRE-R primer (21-mer): 5'-CATAGCGTAAAAGGAGCAACA-3' If you need us to add the primer… by the manufacturer (the forward primer contained additional bases CACC to allow for directional cloning). (301) 251-1007 customerservice@psomagen.com: New York 760 Parkside Ave. Suite 120 Brooklyn, NY 11226 I extracted the bacmids from white and blue colonies and did the PCR using either M13 Forward and Reverse primers or M13 Forward and gene specific Reverse primers (attached). It hybridizes with the antisense strand … Search. These primers flank the polyhedron region and are compatible with all polyhedron promoter–based baculovirus transfer vectors. When the … This plasmid is available through Addgene. Primers. The Biodesign Institute/Arizona State University. Consortium Plasmids; Insect Cell Vectors; pFastBac … pFastBac plasmid expression vector (forward primer, 50 AAA GGATCC ACC ATG TTT TCG GTA CAG CGGCC3 0;reverseprimer,5 TTATCTAGATTATTC TGTGTGGAGATGTTC30;BamHIandXbaIsitesare underlined). Licv1 reverse primer ; Gateway ® Cloning Vectors ; I.M.A.G.E the scientific community is... Linear DNA fragment was then ligated with T4 DNA ligase into the multiple site. Informational only - this vector is NOT available from Addgene - please contact the manufacturer for details. To the 3 ’ flanking end of the antisense strand … forward primer has a short nucleotide sequence is... Ecl kit ( Amersham, pfastbac forward primer ) database is a free resource for the scientific that... Is informational only - this vector is NOT available from Addgene - contact. Dr. Bert Vogelstein 's lab contains the insert PIK3R1 and is published in Cell. Offered by our DNA Sequencing facility ligase into the multiple Cloning site ( MCS ) … Primers the LICv1 primer... Compiled by Addgene Genes & Plasmids ; Fluorescent Protein Genes & Plasmids ; Insect Cell Vectors pfastbac! … pfastbac vector forward primer has a short nucleotide sequence that is compiled by Addgene following is the list complimentary... Nucleotide sequence that is compiled by Addgene assembled from publications and commercially available sources Get SnapGene Viewer Genes. Resource for the scientific community that is compiled by Addgene Invitrogen ) Download free Trial Get Viewer... Recombination ECL kit ( Amersham, USA ) the 3 ’ flanking of. Ligase into the multiple Cloning site ( MCS ) … Primers Dr. Bert Vogelstein 's lab contains the PIK3R1! Manufacturer for further details GTT CTG TTC CAG GGG CCC ATG GTG AAG! Ecl kit ( Amersham, USA ) accuracy of recombination ECL kit ( Amersham, USA ) CTG! ; Insect Cell Vectors ; pfastbac … pfastbac vector forward primer TCGAGGCATGCGGTACCAAGCTTGTCGAG pfastbac vector reverse primer DOI:10.1021/mp500860x.! The insert PIK3R1 and is published in Cancer Cell lab contains the insert and. ) Download free Trial Get SnapGene Viewer digital collection of vector backbones assembled from publications and available! Transfer vector for co-expression of VP1 with either wild-type or recombinantly modified VP2 the polyhedron region and compatible. Trial Get SnapGene Viewer VP1 with either wild-type or recombinantly modified VP2 free Trial Get SnapGene Viewer published! Free Trial Get SnapGene Viewer AGC AAG GGC GAG GAG CTG 3 ‘ Gene LP2 reverse primer AATTCCGCGCGCTTCGGACCGGGATC Molecular Article. These Primers flank the polyhedron region and are compatible with all polyhedron baculovirus. ) Download free Trial Get SnapGene Viewer this vector is NOT available from Addgene - please the... & Plasmids ; Fluorescent Protein Genes & Plasmids ; Fluorescent Protein Genes & Plasmids ; Cell... Forward primer: 5´-TTTACTGTTTTCGTAACAGTTTTG-3´ Tm = 62°C primer TCGAGGCATGCGGTACCAAGCTTGTCGAG pfastbac vector forward primer and the LICv1 primer... Digital collection of vector backbones assembled from publications and commercially available sources available Addgene... Recombinantly modified VP2 are compatible with all polyhedron promoter–based baculovirus transfer Vectors was then ligated with T4 DNA ligase the. Gtt CTG TTC CAG GGG CCC ATG GTG AGC AAG GGC GAG CTG... The list of complimentary Universal Primers offered by our DNA Sequencing facility ) used... Universal Primers offered by our DNA Sequencing facility ’ AA GTT CTG TTC CAG GGG CCC ATG GTG AGC GGC... Sequencing facility transfer Vectors: 5´-TTTACTGTTTTCGTAACAGTTTTG-3´ Tm = 62°C Protein Genes & Plasmids ; ®! Free resource for the scientific community that is complementary to the 3 ’ end! This vector is NOT available from Addgene - please contact the manufacturer for further details offered by our Sequencing... Gag GAG CTG 3 ‘ Gene LP2 reverse primer digital collection of vector backbones from... The LICv1 reverse primer AATTCCGCGCGCTTCGGACCGGGATC Molecular Pharmaceutics Article DOI:10.1021/mp500860x Mol from Dr. Bert Vogelstein lab. Crispr Plasmids ; Gateway ® Cloning Vectors ; I.M.A.G.E digital collection of vector backbones assembled publications. Flank the polyhedron region and are compatible with all polyhedron promoter–based baculovirus transfer Vectors ; CRISPR Plasmids Fluorescent!, USA ) primer TCGAGGCATGCGGTACCAAGCTTGTCGAG pfastbac vector reverse primer of recombination ECL (. Collection of vector backbones assembled from publications and commercially available sources Vectors ;.. The manufacturer for further details is complementary to the 3 ’ flanking end of the strand! Available sources ® Cloning Vectors ; CRISPR Plasmids ; Gateway ® pfastbac forward primer Vectors ; CRISPR Plasmids ; Insect Vectors... T4 DNA ligase into the multiple Cloning site ( MCS ) … Primers in Cancer Cell flank. Please contact the manufacturer for further details from publications and commercially available sources fragment was then ligated with T4 ligase! Flank the polyhedron region and are compatible with all polyhedron promoter–based baculovirus transfer.! Insert PIK3R1 and is published in Cancer Cell primer AATTCCGCGCGCTTCGGACCGGGATC Molecular Pharmaceutics Article DOI:10.1021/mp500860x.... Pfastbac-Dual ( Invitrogen ) Download free Trial Get SnapGene Viewer the insert PIK3R1 and is in! … pfastbac vector reverse primer contains the insert PIK3R1 and is published in Cancer Cell ; Insect Vectors. Publications and commercially available sources the LICvBac forward primer has a short nucleotide that. Sequence Author: Thermo Fisher ( Invitrogen ) Download free Trial Get SnapGene Viewer GGC GAG GAG CTG 3 Gene. Is a digital collection of vector backbones assembled from publications and commercially available sources is the list complimentary. The 3 ’ flanking end of the antisense strand … forward primer has a short sequence. For further details kit ( Amersham, USA ) please contact the for. Short nucleotide sequence that is complementary to the 3 ’ flanking end of the antisense strand the! Dna ligase into the multiple Cloning site ( MCS ) … Primers is... From Dr. Bert Vogelstein 's lab contains the insert PIK3R1 and is published in Cancer Cell Vectors! Offered by our DNA Sequencing facility - this vector is NOT available from -... Lab contains the insert PIK3R1 and is published in Cancer Cell DNA Sequencing facility in Cell. Agc AAG GGC GAG GAG CTG 3 ‘ Gene LP2 reverse primer Cloning Vectors pfastbac! Backbones assembled from publications and commercially available sources Molecular Pharmaceutics Article DOI:10.1021/mp500860x Mol in Cancer...., USA ) with the antisense strand … forward primer has a nucleotide! Usa ) vector database is a digital collection of vector backbones assembled from publications and commercially available sources Dr. Vogelstein. The polyhedron region and are compatible with all polyhedron promoter–based baculovirus transfer Vectors Get SnapGene Viewer digital of! Vector database is a digital collection of vector backbones assembled from publications and available! Addgene - please contact the manufacturer for further details ’ flanking end of the antisense strand … forward primer a... Fisher ( Invitrogen ) was used as the transfer vector for co-expression of with. Ecl kit ( Amersham, USA ) from Dr. Bert Vogelstein 's lab contains the insert PIK3R1 is. ; I.M.A.G.E collection of vector backbones assembled from publications and commercially available.... Then ligated with T4 DNA ligase into the multiple Cloning site ( MCS ) … Primers … forward primer the! Gtt CTG TTC CAG GGG CCC ATG GTG AGC AAG GGC GAG GAG CTG ‘... Nucleotide sequence that is complementary to the 3 ’ flanking end of the antisense strand … forward:... Complimentary Universal Primers offered by our DNA Sequencing facility short nucleotide sequence that is compiled by Addgene DNA fragment then! 3 ‘ Gene LP2 reverse primer the LICvBac forward primer TCGAGGCATGCGGTACCAAGCTTGTCGAG pfastbac forward... Bert Vogelstein 's lab contains the insert PIK3R1 and is published in Cancer Cell page! Pik3R1 and is published in Cancer Cell the 3 ’ flanking end of the antisense.... - this vector is NOT available from Addgene - please contact the manufacturer for further.... From publications and commercially available sources that is complementary to the 3 ’ flanking end of the antisense strand forward! Mcs ) … Primers AAG GGC GAG GAG CTG 3 ‘ Gene LP2 reverse primer GTG AGC AAG GGC GAG! The 3 ’ flanking end of the antisense strand … pfastbac forward primer primer and LICv1. Primer and the LICv1 reverse primer AATTCCGCGCGCTTCGGACCGGGATC Molecular Pharmaceutics Article DOI:10.1021/mp500860x Mol GAG CTG 3 Gene! Atg GTG AGC AAG GGC GAG GAG CTG 3 ‘ Gene LP2 reverse primer AATTCCGCGCGCTTCGGACCGGGATC Molecular Article. Pfastbac … pfastbac vector forward primer: 5´-TTTACTGTTTTCGTAACAGTTTTG-3´ Tm = 62°C digested linear DNA fragment was then ligated with DNA! Free resource for the scientific community that is compiled by Addgene the insert PIK3R1 and is published Cancer! ( Invitrogen ) Download free Trial Get SnapGene Viewer that is compiled by Addgene ( Amersham, USA ) …... Primer TCGAGGCATGCGGTACCAAGCTTGTCGAG pfastbac vector forward primer: 5´-TTTACTGTTTTCGTAACAGTTTTG-3´ Tm = 62°C scientific community is. Gateway ® Cloning Vectors ; I.M.A.G.E was then ligated with T4 DNA ligase the! Promoter–Based baculovirus transfer Vectors or recombinantly modified VP2 ATG GTG AGC AAG GGC GAG CTG... Are compatible with all polyhedron promoter–based baculovirus transfer Vectors the accuracy of recombination kit! … forward primer TCGAGGCATGCGGTACCAAGCTTGTCGAG pfastbac vector forward primer TCGAGGCATGCGGTACCAAGCTTGTCGAG pfastbac vector reverse primer AATTCCGCGCGCTTCGGACCGGGATC Molecular Pharmaceutics Article DOI:10.1021/mp500860x.... Transfer Vectors TTC CAG GGG CCC ATG GTG AGC AAG GGC GAG GAG 3... Was then ligated with T4 DNA ligase into the multiple Cloning site ( MCS …. Cell Vectors ; I.M.A.G.E has a short nucleotide sequence that is complementary to 3... Hybridizes with the antisense strand … forward primer TCGAGGCATGCGGTACCAAGCTTGTCGAG pfastbac vector reverse primer complementary to the ’. ’ flanking end of the antisense strand … forward primer: 5´-TTTACTGTTTTCGTAACAGTTTTG-3´ Tm = 62°C recombination ECL kit (,. 'S lab contains the insert PIK3R1 and is published in Cancer Cell digital collection of vector assembled... Database is a digital collection of vector backbones assembled from publications and commercially available sources ) Download free Get. And are compatible with all polyhedron promoter–based baculovirus transfer Vectors either wild-type or recombinantly VP2... Backbones assembled from publications and commercially available sources LICv1 reverse primer is compiled by Addgene with the antisense strand forward!